|
Zymo Research
bisulfite sequencing service Bisulfite Sequencing Service, supplied by Zymo Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/Targeted+Bisulfite+Sequencing/10__1016_slash_j__isci__2024__111382-234-27-30 Average 90 stars, based on 1 article reviews
bisulfite sequencing service - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rs12979860 target sequence ![]() Rs12979860 Target Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/Rs12979860+target+sequence/pmc03942284-73-1-8 Average 91 stars, based on 1 article reviews
rs12979860 target sequence - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Ribobio co
sirna targeting the junction region of the hsa-circ-0058046 sequence ![]() Sirna Targeting The Junction Region Of The Hsa Circ 0058046 Sequence, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/sirna+targeting+the+junction+region+of+the+hsa+circ+0058046+sequence/pm39895095-57-0-21 Average 90 stars, based on 1 article reviews
sirna targeting the junction region of the hsa-circ-0058046 sequence - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
p53 depletion small interference rna (sirna) sequence target p53 ![]() P53 Depletion Small Interference Rna (Sirna) Sequence Target P53, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/p53+depletion+small+interference+rna++sirna++sequence+target+p53/ppr0413229-58-8-13 Average 90 stars, based on 1 article reviews
p53 depletion small interference rna (sirna) sequence target p53 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Guangzhou Kingmed Diagnostics Group Co Ltd
targeted genomic enrichment and massively parallel sequencing ![]() Targeted Genomic Enrichment And Massively Parallel Sequencing, supplied by Guangzhou Kingmed Diagnostics Group Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/targeted+genomic+enrichment+and+massively+parallel+sequencing/10__1097_slash_md__0000000000041001-79-19-21 Average 90 stars, based on 1 article reviews
targeted genomic enrichment and massively parallel sequencing - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Microsynth ag
rt-qpcr target sequence: canis hprt fw: tggacaggactgagcggc rv: tgagcacacagagggctacg ![]() Rt Qpcr Target Sequence: Canis Hprt Fw: Tggacaggactgagcggc Rv: Tgagcacacagagggctacg, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/rt+qpcr+target+sequence++canis+hprt+fw++tggacaggactgagcggc+rv++tgagcacacagagggctacg/pmc11906862__41467_2025_57428_MOESM1_ESM-106-96-101 Average 90 stars, based on 1 article reviews
rt-qpcr target sequence: canis hprt fw: tggacaggactgagcggc rv: tgagcacacagagggctacg - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Clinical and Laboratory Standards Institute
interpretive criteria for identification of bacteria and fungi by dna target sequencing ![]() Interpretive Criteria For Identification Of Bacteria And Fungi By Dna Target Sequencing, supplied by Clinical and Laboratory Standards Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/interpretive+criteria+for+identification+of+bacteria+and+fungi+by+dna+target+sequencing/10__4081_slash_mm__2011__2337-214-22-5 Average 90 stars, based on 1 article reviews
interpretive criteria for identification of bacteria and fungi by dna target sequencing - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
sirna sequence targeting human pxr gene ![]() Sirna Sequence Targeting Human Pxr Gene, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/sirna+sequence+targeting+human+pxr+gene/pmc04279688-76-4-20 Average 90 stars, based on 1 article reviews
sirna sequence targeting human pxr gene - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
BIOTAGE
amplification sequencing primers genotyping target apoe single nucleotide polymorphisms ![]() Amplification Sequencing Primers Genotyping Target Apoe Single Nucleotide Polymorphisms, supplied by BIOTAGE, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/amplification+sequencing+primers+genotyping+target+apoe+single+nucleotide+polymorphisms/pmc03656458-150-5-27 Average 90 stars, based on 1 article reviews
amplification sequencing primers genotyping target apoe single nucleotide polymorphisms - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
two stealth sirnas targeting different sequences of a1cf mrna ![]() Two Stealth Sirnas Targeting Different Sequences Of A1cf Mrna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/two+stealth+sirnas+targeting+different+sequences+of+a1cf+mrna/pmc04783931-106-16-5 Average 90 stars, based on 1 article reviews
two stealth sirnas targeting different sequences of a1cf mrna - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Ribobio co
tow specific sirna targeting the top 5 upregulated mrnas (cbsl, sorbs2, gage12b, loc101927345, rbm14-rbm4) and negative control (nc) sirna ![]() Tow Specific Sirna Targeting The Top 5 Upregulated Mrnas (Cbsl, Sorbs2, Gage12b, Loc101927345, Rbm14 Rbm4) And Negative Control (Nc) Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/sirna+oligonucleotides+against+rbm14+sirbm14+1++target+sequence++5++gtaaccagccatcctctta+3+++sirbm14+2++target+sequence++5++ccaggcagcttcatataat+3+/pmc06457324-113-15-22 Average 90 stars, based on 1 article reviews
tow specific sirna targeting the top 5 upregulated mrnas (cbsl, sorbs2, gage12b, loc101927345, rbm14-rbm4) and negative control (nc) sirna - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Synbio Technologies LLC
small interfering rnas targeting the thap11 gene coding sequence (cds) region ![]() Small Interfering Rnas Targeting The Thap11 Gene Coding Sequence (Cds) Region, supplied by Synbio Technologies LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+sequence/small+interfering+rnas+targeting+the+thap11+gene+coding+sequence++cds++region/pm40548980-82-1-18 Average 90 stars, based on 1 article reviews
small interfering rnas targeting the thap11 gene coding sequence (cds) region - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BioMed Research International
Article Title: SNP rs8099917 in Gene IL28B Might Be Associated with Risk of Chronic Infection by HCV but Not with Response to Treatment
doi: 10.1155/2014/748606
Figure Lengend Snippet: Genotypic and allelic frequencies of SNP rs12979860 and rs8099917 in gene IL28B in individuals with chronic hepatitis C virus infection and the control group, Belém, 2012.
Article Snippet: The
Techniques: Virus, Infection, Control
Journal: BioMed Research International
Article Title: SNP rs8099917 in Gene IL28B Might Be Associated with Risk of Chronic Infection by HCV but Not with Response to Treatment
doi: 10.1155/2014/748606
Figure Lengend Snippet: Association of SNPs rs12979860 and rs8099917 with sustained virologic response in individuals with chronic hepatitis C treated with PEG-IFN and RBV.
Article Snippet: The
Techniques:
Journal: Cancer Cell International
Article Title: Differential drug resistance acquisition to doxorubicin and paclitaxel in breast cancer cells
doi: 10.1186/s12935-014-0142-4
Figure Lengend Snippet: Impact of PXR activation in DOX and PTX treated cells. (A) PXR mRNA expression with the treatment of DOX and PTX at 0, 4, 8, 12, 24, 36, 48 h. (B) Western blot analysis of PXR with 24 h treatment of DOX and PTX. **, p < 0.01 (n = 3). (C) RT-PCR analysis of PXR mRNA in PTX only (PTX) or treated cells exposed to transfection conditions in the absence of siRNA (mock) or cells transfected with non-targeting (NC) or PXR-specific siRNA (siRNA). (D) Comparison of MDR1 mRNA expression in the cells exposed to transfection conditions with 8 h/36 h DOX and PTX treatment. **, p < 0.01 (n = 3). (E) Rho-123 fluorescence ratio in the cells exposed to transfection conditions with 8 h/36 h DOX and PTX treatment. *, p < 0.05 (n = 3).
Article Snippet: The siRNA sequence targeting
Techniques: Activation Assay, Expressing, Western Blot, Reverse Transcription Polymerase Chain Reaction, Transfection, Comparison, Fluorescence
Journal: International Journal of Molecular Sciences
Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells
doi: 10.3390/ijms17020197
Figure Lengend Snippet: Apobec-1 complementation factor (A1CF) is highly conserved among species. ( a ) A1CF amino acid sequences of human , mouse , rat , chicken , zebrafish , xenopus laevis were selected to analysis. The identical amino acids were shaded in black and the similar amino acids in grey; ( b ) Phylogenetic tree of A1CF amino acids is constructed using MEGA6 software, bootstrap percentages based on 1000 replicates, are shown on each branch. Identity values are listed on the right ranging from 78% to 92%, revealing that A1CF is highly conserved among species.
Article Snippet: SiRNA oligonucleotides were purchased from
Techniques: Construct, Software
Journal: International Journal of Molecular Sciences
Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells
doi: 10.3390/ijms17020197
Figure Lengend Snippet: A1CF is expressed in mouse kidney starting at E15.5d and centers on the kidney tubules in C57BL/6 mice . ( a – c ) Whole mount in situ hybridization demonstrates that A1CF is expressed in the later stage of kidney development of C57BL/6 mice . White dot line indicates the area of metanephros rudiment (original magnification, ×40); ( c ′ ) To clearly prove the expression of A1CF, metanephros of embryonic day 15.5 (E15.5d) was detected with original magnification, ×100; ( d – g ) Section in situ hybridization demonstrates that in the adult mice kidney, A1CF is mainly expressed in the tubules of inner cortex but not in the other parts of the kidney section; ( d ) The black dot line marks the boundary between cortex and medulla. Scale bar represents 30 µm; ( e – g ) Images is the amplification of ( d ). ( e ) Scale bar represents 50 µm; ( f ) Image represents the field surrounding kidney tubules; Scale bar represents 100 µm; ( g ) Image represents the field of kidney tubules. Scale bar represents 100 µm; ( h , i ) In control groups no hybridization signal can be detected; ( h ) Scale bar represents 50 µm; ( i ) Scale bar represents 100 µm.
Article Snippet: SiRNA oligonucleotides were purchased from
Techniques: In Situ Hybridization, Expressing, Amplification, Hybridization
Journal: International Journal of Molecular Sciences
Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells
doi: 10.3390/ijms17020197
Figure Lengend Snippet: Ectopic expression of A1CF inhibits EMT. ( a ) Overexpression A1CF and A1CF (-8AA) both result in gain of epithelial markers (E-cadherin) and loss of mesenchymal markers (vimentin and α-smooth muscle actin (α-SMA)), and the two variants have the similar trend in this process, GAPDH served as loading control; ( b ) Statistical analysis of relative protein expression levels. Data (mean ± standard error of the mean (S.E.M.)) are representative of three independent experiments. * p ≤ 0.05 and ** p ≤ 0.01 indicate significant statistical differences compared with the control group; ( c ) Immunofluorescence analysis demonstrates that ectopic expression of A1CF and A1CF (-8AA) potentiate the expression of membrane E-cadherin in NRK52e cells, and the expression of α-SMA and vimentin is weaker compared with control groups (original magnification, ×40). Scale bar represents 50 µm.
Article Snippet: SiRNA oligonucleotides were purchased from
Techniques: Expressing, Over Expression, Immunofluorescence
Journal: International Journal of Molecular Sciences
Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells
doi: 10.3390/ijms17020197
Figure Lengend Snippet: A1CF knockdown induces EMT. ( a ) Control-siRNA, A1CF-siRNA #1, and A1CF-siRNA #2 were transfected into NRK52e cells. Western blotting analysis reveals a decrease in E-cadherin (epithelial marker) and concomitant increase in vimentin and α-SMA (mesenchymal markers). GAPDH served as loading control; ( b ) Statistical analysis of relative protein expression levels , Data (mean ± S.E.M.) are representative of three independent experiments. ** p ≤ 0.01 indicates highly statistically significant differences compared with control-siRNA group; ( c ) A1CF-siRNA #2 was transfected into NRK52e cells. A1CF knockdown attenuates the expression of membrane E-cadherin and potentiates the expression of α-SMA and vimentin demonstrated by immunofluorescence analysis (original magnification, ×40). Scale bar represents 50 µm.
Article Snippet: SiRNA oligonucleotides were purchased from
Techniques: Transfection, Western Blot, Marker, Expressing, Immunofluorescence
Journal: International Journal of Molecular Sciences
Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells
doi: 10.3390/ijms17020197
Figure Lengend Snippet: A1CF inhibits NRK52e cells migration. ( a ) Both A1CF and A1CF (-8AA) significantly inhibited NRK52e cells migration. Data were collected at 12 and 24 h (original magnification, ×100); ( c ) A1CF knockdown significantly increases NRK52e cells migration. Data were collected at 12 and 24 h (original magnification, ×100); ( b , d ) Data are presented as mean ± S.E.M. of three independent experiments. Statistical analysis was performed using Student’s t -test. ** p < 0.01 indicated significantly statistical differences compared with control groups.
Article Snippet: SiRNA oligonucleotides were purchased from
Techniques: Migration