Journal: BioMed Research International

Article Title: SNP rs8099917 in Gene IL28B Might Be Associated with Risk of Chronic Infection by HCV but Not with Response to Treatment

doi: 10.1155/2014/748606

Figure Lengend Snippet: Genotypic and allelic frequencies of SNP rs12979860 and rs8099917 in gene IL28B in individuals with chronic hepatitis C virus infection and the control group, Belém, 2012.

Article Snippet: The rs12979860 target sequence was sent to the Applied Biosystems company, which designed the following primer and probe sequences: 5′-GCC TGT CGT GTA CTG AAC CA-3′ (forward), 5′-GCG CGG AGT TGC AAT TCA AC-3′ (reverse), 5′VIC-TGG TTC GCG CTT C-3′ (allele C probe), and 5′FAM-CTG GTT CAC GCC TTC-3′ (allele T probe).

Techniques: Virus, Infection, Control

Journal: BioMed Research International

Article Title: SNP rs8099917 in Gene IL28B Might Be Associated with Risk of Chronic Infection by HCV but Not with Response to Treatment

doi: 10.1155/2014/748606

Figure Lengend Snippet: Association of SNPs rs12979860 and rs8099917 with sustained virologic response in individuals with chronic hepatitis C treated with PEG-IFN and RBV.

Article Snippet: The rs12979860 target sequence was sent to the Applied Biosystems company, which designed the following primer and probe sequences: 5′-GCC TGT CGT GTA CTG AAC CA-3′ (forward), 5′-GCG CGG AGT TGC AAT TCA AC-3′ (reverse), 5′VIC-TGG TTC GCG CTT C-3′ (allele C probe), and 5′FAM-CTG GTT CAC GCC TTC-3′ (allele T probe).

Techniques:

Journal: Cell Death & Disease

Article Title: Maintenance of magnesium homeostasis by NUF2 promotes protein synthesis and anaplastic thyroid cancer progression

doi: 10.1038/s41419-024-07041-6

Figure Lengend Snippet: The antibody used for Western blot.

Article Snippet: siRNAs targeting human NUF2 (the sense sequence was GCCGTGAAACGTATATGGAAT and the anti-sense sequence was AUUCCAUAUACGUUUCACGGC), MAGT1 (the sense sequence was GCTCATCGTTTGCGACGTT and the anti-sense sequence was AACGUCGCAAACGAUGAGC), NIPA1 (the sense sequence was GCCCAAGACATCTTGCATA and the anti-sense sequence was UAUGCAAGAUGUCUUGGGC), and NIPAL1 (the sense sequence was GCTCCAGCTTCATACTGAA and the anti-sense sequence was UUCAGAUGAAGCUGGAGC) were purchased from RiboBio (Guangzhou, China).

Techniques: Western Blot, Concentration Assay

Journal: Cell Death & Disease

Article Title: Maintenance of magnesium homeostasis by NUF2 promotes protein synthesis and anaplastic thyroid cancer progression

doi: 10.1038/s41419-024-07041-6

Figure Lengend Snippet: The primers used for RT-qPCR.

Article Snippet: siRNAs targeting human NUF2 (the sense sequence was GCCGTGAAACGTATATGGAAT and the anti-sense sequence was AUUCCAUAUACGUUUCACGGC), MAGT1 (the sense sequence was GCTCATCGTTTGCGACGTT and the anti-sense sequence was AACGUCGCAAACGAUGAGC), NIPA1 (the sense sequence was GCCCAAGACATCTTGCATA and the anti-sense sequence was UAUGCAAGAUGUCUUGGGC), and NIPAL1 (the sense sequence was GCTCCAGCTTCATACTGAA and the anti-sense sequence was UUCAGAUGAAGCUGGAGC) were purchased from RiboBio (Guangzhou, China).

Techniques: Sequencing

Journal: Cell Death & Disease

Article Title: Maintenance of magnesium homeostasis by NUF2 promotes protein synthesis and anaplastic thyroid cancer progression

doi: 10.1038/s41419-024-07041-6

Figure Lengend Snippet: The primers used for ChIP-qPCR.

Article Snippet: siRNAs targeting human NUF2 (the sense sequence was GCCGTGAAACGTATATGGAAT and the anti-sense sequence was AUUCCAUAUACGUUUCACGGC), MAGT1 (the sense sequence was GCTCATCGTTTGCGACGTT and the anti-sense sequence was AACGUCGCAAACGAUGAGC), NIPA1 (the sense sequence was GCCCAAGACATCTTGCATA and the anti-sense sequence was UAUGCAAGAUGUCUUGGGC), and NIPAL1 (the sense sequence was GCTCCAGCTTCATACTGAA and the anti-sense sequence was UUCAGAUGAAGCUGGAGC) were purchased from RiboBio (Guangzhou, China).

Techniques: Sequencing

Journal: Cell Death & Disease

Article Title: Maintenance of magnesium homeostasis by NUF2 promotes protein synthesis and anaplastic thyroid cancer progression

doi: 10.1038/s41419-024-07041-6

Figure Lengend Snippet: A Top 20 of GO enrichment according to the data of RNA-sequencing in 8505C cells which were transfected with siRNA-NUF2 and siRNA-NC, respectively . B The expression levels of genes in magnesium ion transport pathway. C , D The mRNA and protein levels of MAGT1, NIPA1, and NIPAL1 in NUF2-WT and NUF2-KD ATC cells. E The intracellular Mg 2+ concentration of Nthy-ori 3-1, BCPAP, KHM-5M, and 8505C cell lines. F The intracellular Mg 2+ concentration of NUF2-WT and NUF2-KD ATC cells (8505C, KHM-5M). Data are presented as the mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: siRNAs targeting human NUF2 (the sense sequence was GCCGTGAAACGTATATGGAAT and the anti-sense sequence was AUUCCAUAUACGUUUCACGGC), MAGT1 (the sense sequence was GCTCATCGTTTGCGACGTT and the anti-sense sequence was AACGUCGCAAACGAUGAGC), NIPA1 (the sense sequence was GCCCAAGACATCTTGCATA and the anti-sense sequence was UAUGCAAGAUGUCUUGGGC), and NIPAL1 (the sense sequence was GCTCCAGCTTCATACTGAA and the anti-sense sequence was UUCAGAUGAAGCUGGAGC) were purchased from RiboBio (Guangzhou, China).

Techniques: RNA Sequencing Assay, Transfection, Expressing, Concentration Assay

Journal: Cell Death & Disease

Article Title: Maintenance of magnesium homeostasis by NUF2 promotes protein synthesis and anaplastic thyroid cancer progression

doi: 10.1038/s41419-024-07041-6

Figure Lengend Snippet: A Cell viability of 8505C and KHM-5M cells transfected with siMNN (MAGT1 + NIPA1 + NIPAL1) or siRNA-NC. B Colony formation of control or siMNN 8505 C and KHM-5M cells. C Apoptosis of control and siMNN ATC cells. Growth curve ( D ) and colony formation ( E ) of BCPAP cells with NUF2 overexpression and siMNN. Data are presented as the mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: siRNAs targeting human NUF2 (the sense sequence was GCCGTGAAACGTATATGGAAT and the anti-sense sequence was AUUCCAUAUACGUUUCACGGC), MAGT1 (the sense sequence was GCTCATCGTTTGCGACGTT and the anti-sense sequence was AACGUCGCAAACGAUGAGC), NIPA1 (the sense sequence was GCCCAAGACATCTTGCATA and the anti-sense sequence was UAUGCAAGAUGUCUUGGGC), and NIPAL1 (the sense sequence was GCTCCAGCTTCATACTGAA and the anti-sense sequence was UUCAGAUGAAGCUGGAGC) were purchased from RiboBio (Guangzhou, China).

Techniques: Transfection, Control, Over Expression

Journal: Cell Death & Disease

Article Title: Maintenance of magnesium homeostasis by NUF2 promotes protein synthesis and anaplastic thyroid cancer progression

doi: 10.1038/s41419-024-07041-6

Figure Lengend Snippet: A Relative luciferase activity in 293T cells treated with pcDNA3.1 empty vector and NUF2 plasmids. B Max-Z score of H3K4me3 and H3K27ac in the thyroid glands of four patients. C Double immunofluorescence for NUF2 and H3K4me3 in 8505 C and Nthy-ori 3-1 cells. D Coimmunoprecipitation (CoIP) assay of NUF2, H3K4me3 and H3K27ac. E – G The abundance of H3K4me3 at the MAGT1, NIPA1 and NIPAL1 promoters in ATC cell lines was analyzed by chromatin immunoprecipitation. Data are presented as the mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: siRNAs targeting human NUF2 (the sense sequence was GCCGTGAAACGTATATGGAAT and the anti-sense sequence was AUUCCAUAUACGUUUCACGGC), MAGT1 (the sense sequence was GCTCATCGTTTGCGACGTT and the anti-sense sequence was AACGUCGCAAACGAUGAGC), NIPA1 (the sense sequence was GCCCAAGACATCTTGCATA and the anti-sense sequence was UAUGCAAGAUGUCUUGGGC), and NIPAL1 (the sense sequence was GCTCCAGCTTCATACTGAA and the anti-sense sequence was UUCAGAUGAAGCUGGAGC) were purchased from RiboBio (Guangzhou, China).

Techniques: Luciferase, Activity Assay, Plasmid Preparation, Immunofluorescence, Co-Immunoprecipitation Assay, Chromatin Immunoprecipitation

Journal: Cancer Science

Article Title: miR-639 regulates transforming growth factor beta-induced epithelial–mesenchymal transition in human tongue cancer cells by targeting FOXC1

doi: 10.1111/cas.12499

Figure Lengend Snippet: Correlation among clinicopathological status and the expression of miR-639 and Foxc1 in tongue squamous cell carcinoma patients

Article Snippet: All miRNA mimics, miRNA antisense oligonucleotides (ASO) and FOXC1 siRNA were obtained from GenePharma (Shanghai, China).

Techniques: Expressing

Journal: Cancer Science

Article Title: miR-639 regulates transforming growth factor beta-induced epithelial–mesenchymal transition in human tongue cancer cells by targeting FOXC1

doi: 10.1111/cas.12499

Figure Lengend Snippet: miR-639 targets to FOXC1 3′-untranslated region (UTR). (a) Target sequence of miR-639 in FOXC1 3′-UTR predicted by TargetScan and mutation of the sequence. (b) Luciferase assay was performed in transforming growth factor beta (TGFβ)-treated SCC9 and CAL27 cells that were co-transfected with miRNA mimics and reporter vectors carrying FOXC1 3′-UTR with a wild-type ( FOXC1 3′-UTR) or mutated miR-639 response element ( FOXC1 3′-UTR mut). ** P < 0.01 versus parental tongue squamous cell carcinoma cells. ## P < 0.01 versus mock transfection. (c,d) FOXC1 and miR-639 expressions in SCC9 and CAL27 cells following TGFβ1 stimulation were determined using western blotting and qPCR. (e,f) FOXC1 protein expression was determined in SCC9 (TGFβ) or CAL27 (TGFβ) cells that were transfected with miRNA mimics and in SCC9 or CAL27 cells transfected with miRNA ASO. β-actin was used as an internal control.

Article Snippet: All miRNA mimics, miRNA antisense oligonucleotides (ASO) and FOXC1 siRNA were obtained from GenePharma (Shanghai, China).

Techniques: Sequencing, Mutagenesis, Luciferase, Transfection, Western Blot, Expressing, Control

Journal: Cancer Science

Article Title: miR-639 regulates transforming growth factor beta-induced epithelial–mesenchymal transition in human tongue cancer cells by targeting FOXC1

doi: 10.1111/cas.12499

Figure Lengend Snippet: Silencing FOXC1 expression suppressed transforming growth factor beta (TGFβ)-induced epithelial-to-mesenchymal transition (EMT) in SCC9 cells. (a) FOXC1 and snail mRNA expressions were demonstrated using qPCR. ** P < 0.01 versus mock transfection. (b) Western blotting and (c) immunofluorescence staining illustrated that E-cadherin (E-cad) expression was increased and vimentin (Vim) and snail expressions were reduced when transfected with FOXC1-siRNA. β-actin was used as an internal control. Nuclei are shown in blue. Bar, 30 μm. (d) Modified Boyden chamber assays demonstrated reduced invasion and migration of SCC9 (TGFβ) cells (original magnification, ×100).

Article Snippet: All miRNA mimics, miRNA antisense oligonucleotides (ASO) and FOXC1 siRNA were obtained from GenePharma (Shanghai, China).

Techniques: Expressing, Transfection, Western Blot, Immunofluorescence, Staining, Control, Modification, Migration

Journal: Cancer Science

Article Title: miR-639 regulates transforming growth factor beta-induced epithelial–mesenchymal transition in human tongue cancer cells by targeting FOXC1

doi: 10.1111/cas.12499

Figure Lengend Snippet: Downregulation of miR-639 correlates with lymph node metastasis and poor patient prognosis. (a) In situ hybridization for miR-639 and immunohistochemical staining for TGFβ1 and FOXC1 were demonstrated in tongue squamous cell carcinomas (TSCC) with lymph node metastasis compared with TSCC without lymph node metastasis (original magnification, ×200). (b) Quantification of miR-639 and FOXC1 expression in TSCC with lymph node metastasis compared with TSCC without lymph node metastasis. *** P < 0.001. (c) Associations between TGFβ1 expression and miR-639 expression, and miR-639 expression and FOXC1 expression in TSCC were analyzed with Spearman order correlation. Kaplan–Meier survival curves for TSCC patients are plotted on miR-639 expression (d) or FOXC1 expression (e), and the survival difference was analyzed using the log-rank test.

Article Snippet: All miRNA mimics, miRNA antisense oligonucleotides (ASO) and FOXC1 siRNA were obtained from GenePharma (Shanghai, China).

Techniques: In Situ Hybridization, Immunohistochemical staining, Staining, Expressing